ID: 1197199085_1197199087

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1197199085 1197199087
Species Human (GRCh38) Human (GRCh38)
Location X:123733165-123733187 X:123733178-123733200
Sequence CCGAGGCAAGGCAGCCAACGACG GCCAACGACGTGGAGACTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71} {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!