ID: 1197426445_1197426448

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1197426445 1197426448
Species Human (GRCh38) Human (GRCh38)
Location X:126302866-126302888 X:126302894-126302916
Sequence CCAATAGAGTCCTGGTAATCTAA TTTTTCAAAATATCAAATGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 76, 4: 854}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!