ID: 1197721803_1197721812

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1197721803 1197721812
Species Human (GRCh38) Human (GRCh38)
Location X:129750410-129750432 X:129750460-129750482
Sequence CCGAGTGCCAAAGGCAAGGTCTG GCTTCTAGGGAGCACTTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 235} {0: 1, 1: 0, 2: 2, 3: 11, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!