ID: 1197728867_1197728876

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1197728867 1197728876
Species Human (GRCh38) Human (GRCh38)
Location X:129793940-129793962 X:129793962-129793984
Sequence CCTGCTTCCCCAGGGACACTTAG GGGCCACAGAGGCCAGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 232} {0: 1, 1: 1, 2: 8, 3: 85, 4: 716}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!