ID: 1197782642_1197782651

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1197782642 1197782651
Species Human (GRCh38) Human (GRCh38)
Location X:130172607-130172629 X:130172622-130172644
Sequence CCCTACCCCGAGCAGCGGCACCT CGGCACCTGTGGGCAGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 37, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!