ID: 1198006795_1198006800

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1198006795 1198006800
Species Human (GRCh38) Human (GRCh38)
Location X:132503209-132503231 X:132503238-132503260
Sequence CCAGGCTGTTTTGGGTGGTTCTG CAGAATAAGCCAGAGGAGGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!