ID: 1198235994_1198236007

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1198235994 1198236007
Species Human (GRCh38) Human (GRCh38)
Location X:134736464-134736486 X:134736497-134736519
Sequence CCCAAACCGCCCCCACCGCCCCG CTTAAGGCCCAAGTGACCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 377} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!