ID: 1198441367_1198441378

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1198441367 1198441378
Species Human (GRCh38) Human (GRCh38)
Location X:136666612-136666634 X:136666646-136666668
Sequence CCTCAATTTCCAGTGACCTTCCC ATTTCTCTTGTCTTTTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 251} {0: 1, 1: 0, 2: 4, 3: 39, 4: 551}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!