ID: 1198807288_1198807295

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1198807288 1198807295
Species Human (GRCh38) Human (GRCh38)
Location X:140504699-140504721 X:140504734-140504756
Sequence CCGCCCGAGTTCGCGCCGCCGGC ACTCTTGCCTGCGCCTCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79} {0: 1, 1: 0, 2: 1, 3: 49, 4: 1250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!