ID: 1199278680_1199278684

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1199278680 1199278684
Species Human (GRCh38) Human (GRCh38)
Location X:145974631-145974653 X:145974659-145974681
Sequence CCATCTAACCACAAGAACAAGAT TCGTAGAAAAACAAGCAATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 107, 3: 5926, 4: 7296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!