ID: 1199420403_1199420407

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1199420403 1199420407
Species Human (GRCh38) Human (GRCh38)
Location X:147637483-147637505 X:147637501-147637523
Sequence CCCTGCAAAGTCACAGGGGTGGA GTGGAACTACCCAAGGCCATGGG
Strand - +
Off-target summary {0: 35, 1: 519, 2: 878, 3: 1409, 4: 1573} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!