ID: 1199518220_1199518222

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1199518220 1199518222
Species Human (GRCh38) Human (GRCh38)
Location X:148703368-148703390 X:148703419-148703441
Sequence CCATTCATGAACTGGTAACAGGT ATATCTGTTTCCCACGTTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!