ID: 1199607486_1199607495

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1199607486 1199607495
Species Human (GRCh38) Human (GRCh38)
Location X:149587446-149587468 X:149587481-149587503
Sequence CCCCCAGTGCGCACGTCAGTGAC CCCCAAGCCTGGAGCTTCCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 64} {0: 2, 1: 3, 2: 6, 3: 51, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!