ID: 1199631012_1199631022

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1199631012 1199631022
Species Human (GRCh38) Human (GRCh38)
Location X:149776600-149776622 X:149776646-149776668
Sequence CCTTTTGCCATCTCTGGGTACCG TGCACAGCCTGCTGCCTCCATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 116} {0: 2, 1: 0, 2: 4, 3: 39, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!