ID: 1199850391_1199850396

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1199850391 1199850396
Species Human (GRCh38) Human (GRCh38)
Location X:151721741-151721763 X:151721755-151721777
Sequence CCCTCAAGGCCCTAGGCCCTCTT GGCCCTCTTTACCATGGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 187} {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!