ID: 1199880948_1199880958

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1199880948 1199880958
Species Human (GRCh38) Human (GRCh38)
Location X:151974180-151974202 X:151974199-151974221
Sequence CCCCCCCAGTAGCTGAAGCCTGC CTGCCCTGGCCGGTCACCCCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!