ID: 1200000856_1200000863

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1200000856 1200000863
Species Human (GRCh38) Human (GRCh38)
Location X:153059065-153059087 X:153059085-153059107
Sequence CCTAAGGCCCCGGGAGCCCAGTG GTGCCAGCCAGAGGTTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 423} {0: 1, 1: 0, 2: 3, 3: 20, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!