ID: 1200053326_1200053335

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1200053326 1200053335
Species Human (GRCh38) Human (GRCh38)
Location X:153445992-153446014 X:153446015-153446037
Sequence CCACCACACCAGCTTACCTGGGG CGGGCACTGACCGGCTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 221} {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!