ID: 1200053924_1200053940

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1200053924 1200053940
Species Human (GRCh38) Human (GRCh38)
Location X:153448868-153448890 X:153448898-153448920
Sequence CCCCTGCCCCCCAAGCCCCAGGG ATGGCACACAGTGAGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 156, 4: 1962} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!