ID: 1200093862_1200093867

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1200093862 1200093867
Species Human (GRCh38) Human (GRCh38)
Location X:153648190-153648212 X:153648204-153648226
Sequence CCTGTACGACCAGGGCGGGGGCC GCGGGGGCCGGCGCCGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 71} {0: 1, 1: 1, 2: 20, 3: 290, 4: 1580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!