ID: 1200093870_1200093883

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1200093870 1200093883
Species Human (GRCh38) Human (GRCh38)
Location X:153648211-153648233 X:153648251-153648273
Sequence CCGGCGCCGGCGCGGGGAGGCCG TGGGAGGCCGAGTCGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 374} {0: 1, 1: 0, 2: 1, 3: 20, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!