ID: 1200107855_1200107873

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1200107855 1200107873
Species Human (GRCh38) Human (GRCh38)
Location X:153724654-153724676 X:153724689-153724711
Sequence CCCACGTCTCTGTGGTGCGGGAG GGGGCGAGAACGGGAGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76} {0: 1, 1: 1, 2: 0, 3: 44, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!