ID: 1200128732_1200128741

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1200128732 1200128741
Species Human (GRCh38) Human (GRCh38)
Location X:153830122-153830144 X:153830151-153830173
Sequence CCTACCTTGTCCTCCTCGAGCCC TCTCCCACGCCCGCCGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 483} {0: 1, 1: 0, 2: 0, 3: 18, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!