ID: 1200128736_1200128746

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1200128736 1200128746
Species Human (GRCh38) Human (GRCh38)
Location X:153830142-153830164 X:153830163-153830185
Sequence CCCTCCCGCTCTCCCACGCCCGC GCCGCTCCGGGCCTCCCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 659} {0: 1, 1: 0, 2: 1, 3: 14, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!