ID: 1200135146_1200135154

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1200135146 1200135154
Species Human (GRCh38) Human (GRCh38)
Location X:153871166-153871188 X:153871209-153871231
Sequence CCACTTGGGGGCACCTAGAAGGG CTCCTGGTCCAGATGGTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 114} {0: 1, 1: 0, 2: 1, 3: 18, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!