ID: 1200143357_1200143371

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1200143357 1200143371
Species Human (GRCh38) Human (GRCh38)
Location X:153913087-153913109 X:153913139-153913161
Sequence CCAGGGGTCTTCAAGGCATCCCA CAGGCGGGAGGGGAGGACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160} {0: 1, 1: 0, 2: 3, 3: 68, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!