ID: 1200155263_1200155266

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1200155263 1200155266
Species Human (GRCh38) Human (GRCh38)
Location X:153971704-153971726 X:153971725-153971747
Sequence CCACAGGAGCCGCTTCAAAGAGC GCTAGAGTTAGGCCCCGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101} {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!