ID: 1200239485_1200239491

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1200239485 1200239491
Species Human (GRCh38) Human (GRCh38)
Location X:154486369-154486391 X:154486390-154486412
Sequence CCGCGGCCCCCAGACGGCGAAGC GCCCACGCGTCCGCCCCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117} {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!