ID: 1200375889_1200375893

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1200375889 1200375893
Species Human (GRCh38) Human (GRCh38)
Location X:155779829-155779851 X:155779870-155779892
Sequence CCCTGTGTCCTATAGATCATTGT TAGTGCCCCATTTGGACCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149} {0: 1, 1: 0, 2: 1, 3: 2, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!