ID: 1200468058_1200468062

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1200468058 1200468062
Species Human (GRCh38) Human (GRCh38)
Location Y:3545917-3545939 Y:3545958-3545980
Sequence CCTGGGGTCAGAAGAGGGGCGAT ACCCTACCTGGCATCTCAATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!