ID: 1200501437_1200501442

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1200501437 1200501442
Species Human (GRCh38) Human (GRCh38)
Location Y:3955277-3955299 Y:3955290-3955312
Sequence CCCCTTTTGTTCTATTTAGGCCC ATTTAGGCCCTCAGGAGATTGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 22, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!