ID: 1200998276_1200998282

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1200998276 1200998282
Species Human (GRCh38) Human (GRCh38)
Location Y:9400424-9400446 Y:9400474-9400496
Sequence CCTTTCGTACATGTAGAAATTCC TCCAGGACGTTCATGGCATTGGG
Strand - +
Off-target summary {0: 9, 1: 4, 2: 2, 3: 9, 4: 76} {0: 9, 1: 1, 2: 3, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!