ID: 1201361929_1201361932

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1201361929 1201361932
Species Human (GRCh38) Human (GRCh38)
Location Y:13161410-13161432 Y:13161430-13161452
Sequence CCCAACTGGGAAGGCTGTACTTG TTGATGATGAGGAAAGCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 124} {0: 1, 1: 0, 2: 2, 3: 17, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!