ID: 1201491821_1201491829

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1201491821 1201491829
Species Human (GRCh38) Human (GRCh38)
Location Y:14549921-14549943 Y:14549947-14549969
Sequence CCCTGGGACCTTCACCCCATCTG CTAATGAGCTTCCTGCCTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!