ID: 1202167055_1202167061

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1202167055 1202167061
Species Human (GRCh38) Human (GRCh38)
Location Y:22000822-22000844 Y:22000857-22000879
Sequence CCACTTTCTTATTCCAGCCTTCT ACTTTCCTTGCTGGAGATGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!