ID: 1202168780_1202168785

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1202168780 1202168785
Species Human (GRCh38) Human (GRCh38)
Location Y:22019167-22019189 Y:22019183-22019205
Sequence CCTGCTACACCAAACCAAGGTCT AAGGTCTCATCCTCCCATTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!