ID: 1202263917_1202263922

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1202263917 1202263922
Species Human (GRCh38) Human (GRCh38)
Location Y:22998311-22998333 Y:22998335-22998357
Sequence CCATCGTGGCTCTGCCTTCAAAG GAAATTTTACATATGTCACTGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 16, 4: 231} {0: 4, 1: 0, 2: 2, 3: 19, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!