ID: 1202309552_1202309554

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1202309552 1202309554
Species Human (GRCh38) Human (GRCh38)
Location Y:23513282-23513304 Y:23513295-23513317
Sequence CCAATTACAACCAGAGGTAATAT GAGGTAATATACATAGAACAAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 20, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!