ID: 1202493261_1202493274

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1202493261 1202493274
Species Human (GRCh38) Human (GRCh38)
Location Y:25419481-25419503 Y:25419533-25419555
Sequence CCTGTTATCATATCCTGCCATCT TCAGACCCAGGCGTGACCACTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 10, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!