ID: 1202624454_1202624458

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1202624454 1202624458
Species Human (GRCh38) Human (GRCh38)
Location Y:56843086-56843108 Y:56843126-56843148
Sequence CCTACTGGGGACATTGTGACATA CTGGTGATGTAACATTTGTCTGG
Strand - +
Off-target summary {0: 15, 1: 72, 2: 196, 3: 365, 4: 810} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!