ID: 1202784006_1202784009

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1202784006 1202784009
Species Human (GRCh38) Human (GRCh38)
Location 9_KI270718v1_random:30079-30101 9_KI270718v1_random:30103-30125
Sequence CCTTCTGTCACCAAATCTAGAGT ACATGGCATCTGTACAAGCTAGG
Strand - +
Off-target summary No data {0: 9, 1: 2, 2: 1, 3: 7, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!