ID: 1202860824_1202860839

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1202860824 1202860839
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:80006-80028 14_GL000225v1_random:80045-80067
Sequence CCCGTCCCCGGGCTTCTGCGGGG GTGTCGGGAGGGCCATCGCGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!