ID: 1202872650_1202872663

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1202872650 1202872663
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:177967-177989 14_GL000225v1_random:178000-178022
Sequence CCTCCGAGCCCGGGCATGGGCCG GGTCCCTGGAGCCCCCCTGACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!