ID: 1202951977_1202951982

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1202951977 1202951982
Species Human (GRCh38) Human (GRCh38)
Location 15_KI270727v1_random:47926-47948 15_KI270727v1_random:47942-47964
Sequence CCTACCACCTTCTCCCACGACTC ACGACTCCAACATAAGAAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!