ID: 1202966226_1202966228

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1202966226 1202966228
Species Human (GRCh38) Human (GRCh38)
Location 15_KI270727v1_random:178973-178995 15_KI270727v1_random:178986-179008
Sequence CCGGCACGCAAGGTGAGCTCTGC TGAGCTCTGCGTGCGCCCGGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!