ID: 1203070899_1203070916

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1203070899 1203070916
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1073732-1073754 16_KI270728v1_random:1073773-1073795
Sequence CCGCGGCGGGCAAAAAGCCACGG CAGCGGCGGTGGCGGCGGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!