ID: 1203090048_1203090056

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1203090048 1203090056
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1207830-1207852 16_KI270728v1_random:1207845-1207867
Sequence CCTGCCCCAGTGAGCCCAGTCTG CCAGTCTGATGGAGGAGACACGG
Strand - +
Off-target summary No data {0: 10, 1: 14, 2: 27, 3: 59, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!