ID: 1203090055_1203090064

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1203090055 1203090064
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1207845-1207867 16_KI270728v1_random:1207877-1207899
Sequence CCAGTCTGATGGAGGAGACACGG TCAGGGCACCCCCCTCTGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!