ID: 1203447864_1203447870

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1203447864 1203447870
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000219v1:76691-76713 Un_GL000219v1:76741-76763
Sequence CCTAGCTTGTACAGATGCCATGT TTAAAGGCTAGAACTAGATAGGG
Strand - +
Off-target summary {0: 9, 1: 2, 2: 1, 3: 7, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!