ID: 1203699388_1203699389

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1203699388 1203699389
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000214v1:123381-123403 Un_GL000214v1:123399-123421
Sequence CCTCTTCTGCTGGCAAGAGTGTG GTGTGACAGTAGCAAGTAGATGG
Strand - +
Off-target summary No data {0: 28, 1: 9, 2: 0, 3: 24, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!